ID: 1135856421_1135856425

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1135856421 1135856425
Species Human (GRCh38) Human (GRCh38)
Location 16:26015318-26015340 16:26015333-26015355
Sequence CCAACCAAGGAAGAAATGCAGAA ATGCAGAAGCAGAATCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 422} {0: 1, 1: 0, 2: 1, 3: 18, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!