ID: 1135861947_1135861957

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1135861947 1135861957
Species Human (GRCh38) Human (GRCh38)
Location 16:26064297-26064319 16:26064344-26064366
Sequence CCCTATCCAAAAAAAAAGTTTCC CTTAGGGTATAGAGGGTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 121, 4: 870} {0: 1, 1: 0, 2: 1, 3: 10, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!