ID: 1135866810_1135866814

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1135866810 1135866814
Species Human (GRCh38) Human (GRCh38)
Location 16:26110810-26110832 16:26110829-26110851
Sequence CCTTCCACTGTCTCCCTCTCTCA CTCACGCTCTCCAGCTACACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 214, 4: 1918} {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!