ID: 1135901540_1135901549

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1135901540 1135901549
Species Human (GRCh38) Human (GRCh38)
Location 16:26464650-26464672 16:26464690-26464712
Sequence CCTGGGGCAGGTTTTCAAACCTA AAACAGACTGAGGGCTATTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 24, 3: 65, 4: 293} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!