ID: 1135926034_1135926042

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1135926034 1135926042
Species Human (GRCh38) Human (GRCh38)
Location 16:26694897-26694919 16:26694935-26694957
Sequence CCTCTGAAGCCATGGTCTGAGCT TCAGCCATGGCCAGATCAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 23, 3: 250, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!