ID: 1135933355_1135933360

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1135933355 1135933360
Species Human (GRCh38) Human (GRCh38)
Location 16:26758156-26758178 16:26758187-26758209
Sequence CCCAGATTTTTTCTTAACAATCC CTGTGAACAAAGAGATGCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!