ID: 1135989152_1135989161

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1135989152 1135989161
Species Human (GRCh38) Human (GRCh38)
Location 16:27206885-27206907 16:27206931-27206953
Sequence CCAGCAAGAGAGTGTTTCCCCAG GGCCATTTTGCATGGCTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111} {0: 1, 1: 0, 2: 2, 3: 6, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!