ID: 1135992890_1135992907

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1135992890 1135992907
Species Human (GRCh38) Human (GRCh38)
Location 16:27228556-27228578 16:27228608-27228630
Sequence CCCTCCAGATCCATCACAGCACC CCTCCCCTCCAGATCCATCATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 22, 4: 214} {0: 4, 1: 2, 2: 17, 3: 81, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!