ID: 1135992984_1135993000

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1135992984 1135993000
Species Human (GRCh38) Human (GRCh38)
Location 16:27228837-27228859 16:27228888-27228910
Sequence CCTCCAGATGCATCATGGTACCC CCTCCCCTACAGATCCATCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 95} {0: 1, 1: 4, 2: 1, 3: 28, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!