ID: 1136025547_1136025553

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1136025547 1136025553
Species Human (GRCh38) Human (GRCh38)
Location 16:27465953-27465975 16:27465974-27465996
Sequence CCAGGCCCCTTCTACACACCCTA TACTTTTGCCTACACTAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 228} {0: 1, 1: 0, 2: 0, 3: 3, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!