ID: 1136031293_1136031297

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1136031293 1136031297
Species Human (GRCh38) Human (GRCh38)
Location 16:27504998-27505020 16:27505034-27505056
Sequence CCATGCATCTACTCCGTGCTAGG ACTCAGTGTTTCCAAAATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104} {0: 1, 1: 0, 2: 0, 3: 29, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!