ID: 1136041662_1136041671

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1136041662 1136041671
Species Human (GRCh38) Human (GRCh38)
Location 16:27584270-27584292 16:27584302-27584324
Sequence CCACGGCCCCAGATAGAGACTCG CTAGGGTTGTGCACTTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 294} {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!