ID: 1136041666_1136041674

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1136041666 1136041674
Species Human (GRCh38) Human (GRCh38)
Location 16:27584278-27584300 16:27584316-27584338
Sequence CCAGATAGAGACTCGCTGGCCCA TTGTCCTGGAGACAAAGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45} {0: 1, 1: 0, 2: 0, 3: 19, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!