ID: 1136048789_1136048796

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1136048789 1136048796
Species Human (GRCh38) Human (GRCh38)
Location 16:27636145-27636167 16:27636194-27636216
Sequence CCCTATCTCAAAATCAAAAATCT GAAAAGTCTGGCCCCCACGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 274, 4: 2260} {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!