ID: 1136049562_1136049569

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1136049562 1136049569
Species Human (GRCh38) Human (GRCh38)
Location 16:27640770-27640792 16:27640810-27640832
Sequence CCGACTGCAAACCTGGGTCCTGA CAGTAGTGCTAAAGGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 154} {0: 1, 1: 0, 2: 2, 3: 19, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!