ID: 1136059833_1136059844

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1136059833 1136059844
Species Human (GRCh38) Human (GRCh38)
Location 16:27718889-27718911 16:27718915-27718937
Sequence CCCTTTGTCCTCCACCGCAGCTG CCTGGGCCTTCCATCTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 195} {0: 1, 1: 0, 2: 4, 3: 34, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!