ID: 1136065747_1136065762

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1136065747 1136065762
Species Human (GRCh38) Human (GRCh38)
Location 16:27757241-27757263 16:27757290-27757312
Sequence CCCGGCTAATTCATATGTCCATC TGGTGGGTAGGGCGGGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 152} {0: 1, 1: 1, 2: 6, 3: 88, 4: 978}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!