ID: 1136067898_1136067905

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1136067898 1136067905
Species Human (GRCh38) Human (GRCh38)
Location 16:27771030-27771052 16:27771054-27771076
Sequence CCCAAGGCTGCCTCCTCCTGGAG CCTTCCCAGAGCACTCCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 358} {0: 1, 1: 0, 2: 2, 3: 42, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!