ID: 1136074683_1136074688

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1136074683 1136074688
Species Human (GRCh38) Human (GRCh38)
Location 16:27808824-27808846 16:27808837-27808859
Sequence CCAGAGCGAGCAGCCTCTGCGGG CCTCTGCGGGGTGGCAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143} {0: 1, 1: 0, 2: 2, 3: 28, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!