ID: 1136074683_1136074689

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1136074683 1136074689
Species Human (GRCh38) Human (GRCh38)
Location 16:27808824-27808846 16:27808847-27808869
Sequence CCAGAGCGAGCAGCCTCTGCGGG GTGGCAGCAGAGGAGAAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143} {0: 1, 1: 1, 2: 3, 3: 109, 4: 641}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!