ID: 1136075024_1136075026

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1136075024 1136075026
Species Human (GRCh38) Human (GRCh38)
Location 16:27811362-27811384 16:27811387-27811409
Sequence CCAAATAATGGTGCATGTGGTGA TTCCATCAGCAGAGGTGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 110} {0: 1, 1: 0, 2: 2, 3: 17, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!