ID: 1136105008_1136105009

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1136105008 1136105009
Species Human (GRCh38) Human (GRCh38)
Location 16:28024176-28024198 16:28024190-28024212
Sequence CCTTCAATGGGGCTGAGGGCAAC GAGGGCAACTCGATGCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142} {0: 1, 1: 0, 2: 1, 3: 2, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!