ID: 1136105480_1136105489

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1136105480 1136105489
Species Human (GRCh38) Human (GRCh38)
Location 16:28027040-28027062 16:28027079-28027101
Sequence CCACTGCACTCAGAAGTGGGACA GGACACACAGCAGTGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 296} {0: 1, 1: 0, 2: 6, 3: 144, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!