ID: 1136110837_1136110844

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1136110837 1136110844
Species Human (GRCh38) Human (GRCh38)
Location 16:28063000-28063022 16:28063021-28063043
Sequence CCGGGGCTCGGGCCTCGATGGCC CCGCGCCGCCCCGGGGGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134} {0: 1, 1: 1, 2: 12, 3: 39, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!