ID: 1136117807_1136117813

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1136117807 1136117813
Species Human (GRCh38) Human (GRCh38)
Location 16:28106331-28106353 16:28106349-28106371
Sequence CCACCACTTCTCCCTTGAATCTG ATCTGAAAACTATAGATGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 328} {0: 1, 1: 0, 2: 0, 3: 11, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!