ID: 1136118494_1136118510

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1136118494 1136118510
Species Human (GRCh38) Human (GRCh38)
Location 16:28112101-28112123 16:28112154-28112176
Sequence CCTGGAACCCTAGCCCCCAGGCT TCCAACTGGAAGGCAACTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 290} {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!