ID: 1136145147_1136145154

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1136145147 1136145154
Species Human (GRCh38) Human (GRCh38)
Location 16:28312135-28312157 16:28312150-28312172
Sequence CCAGCGTCTCCCTGTTGGGCGTG TGGGCGTGGGGAGGAGTTTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100} {0: 1, 1: 0, 2: 4, 3: 66, 4: 578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!