ID: 1136146952_1136146964

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1136146952 1136146964
Species Human (GRCh38) Human (GRCh38)
Location 16:28321450-28321472 16:28321502-28321524
Sequence CCTGGGCACAGGCTGGGATCAGG CCTCCCTTCTGGAGGCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 417} {0: 1, 1: 0, 2: 12, 3: 84, 4: 626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!