|
Left Crispr |
Right Crispr |
| Crispr ID |
1136174981 |
1136174985 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:28510434-28510456
|
16:28510459-28510481
|
| Sequence |
CCGAGCTTGGTCTGTATTTTTAG |
GAGACGGGGTTTCACCATGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 12, 3: 450, 4: 10239} |
{0: 34182, 1: 124688, 2: 145165, 3: 98748, 4: 47715} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|