ID: 1136183836_1136183841

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1136183836 1136183841
Species Human (GRCh38) Human (GRCh38)
Location 16:28573303-28573325 16:28573350-28573372
Sequence CCTGAAGCCAGAGGAGAAGGGAG CCACATCGGAAGCAGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 31, 3: 113, 4: 714} {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!