ID: 1136222182_1136222192

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1136222182 1136222192
Species Human (GRCh38) Human (GRCh38)
Location 16:28835818-28835840 16:28835851-28835873
Sequence CCATCCCATTGCCAAGTCCCTGG GCCATAGTGCTCCCTAACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 317} {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!