ID: 1136236142_1136236149

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1136236142 1136236149
Species Human (GRCh38) Human (GRCh38)
Location 16:28914671-28914693 16:28914720-28914742
Sequence CCTGGATCTCCTGAATCAGCTCC CTCCTCGATCTCCTTTTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 290} {0: 1, 1: 1, 2: 0, 3: 22, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!