ID: 1136238847_1136238854

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1136238847 1136238854
Species Human (GRCh38) Human (GRCh38)
Location 16:28932180-28932202 16:28932210-28932232
Sequence CCTCCATTTTCTTATTTGTAAAA AAGGGTTGGAAGGACTCTGCCGG
Strand - +
Off-target summary {0: 2, 1: 22, 2: 225, 3: 1368, 4: 5788} {0: 1, 1: 0, 2: 2, 3: 14, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!