ID: 1136271874_1136271876

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1136271874 1136271876
Species Human (GRCh38) Human (GRCh38)
Location 16:29153431-29153453 16:29153444-29153466
Sequence CCTGTGTGTTCCTGGACTTCCTA GGACTTCCTAACTCTAGTTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 20, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!