ID: 1136274718_1136274722

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1136274718 1136274722
Species Human (GRCh38) Human (GRCh38)
Location 16:29172251-29172273 16:29172265-29172287
Sequence CCCCATCACGGAGCATTCCACCA ATTCCACCACTCCCGGTCCAAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!