ID: 1136290500_1136290511

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1136290500 1136290511
Species Human (GRCh38) Human (GRCh38)
Location 16:29268597-29268619 16:29268645-29268667
Sequence CCAAGCCATCCTTCAGGAAAGGC GGCTCTAGTGGTCAAGGGTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 22, 4: 210} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!