ID: 1136323754_1136323762

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1136323754 1136323762
Species Human (GRCh38) Human (GRCh38)
Location 16:29505540-29505562 16:29505589-29505611
Sequence CCCTGGTCATGGGACAGGAACTG CCATTTGCAGAATGAGAACAGGG
Strand - +
Off-target summary {0: 11, 1: 3, 2: 1, 3: 20, 4: 170} {0: 13, 1: 1, 2: 3, 3: 35, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!