|
Left Crispr |
Right Crispr |
| Crispr ID |
1136323755 |
1136323763 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:29505541-29505563
|
16:29505590-29505612
|
| Sequence |
CCTGGTCATGGGACAGGAACTGT |
CATTTGCAGAATGAGAACAGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 4, 2: 2, 3: 30, 4: 239} |
{0: 13, 1: 0, 2: 2, 3: 37, 4: 367} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|