ID: 1136344268_1136344283

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1136344268 1136344283
Species Human (GRCh38) Human (GRCh38)
Location 16:29664851-29664873 16:29664897-29664919
Sequence CCACTGGTGGCCAGTGAGGATGG ATGAGCCCGAAGGGGGAGACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 73, 4: 290} {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!