ID: 1136355686_1136355692

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1136355686 1136355692
Species Human (GRCh38) Human (GRCh38)
Location 16:29743969-29743991 16:29744001-29744023
Sequence CCATTTCCTGACTATCTAGTACC TCATCTGGATGCGATCTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143} {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!