ID: 1136395833_1136395838

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1136395833 1136395838
Species Human (GRCh38) Human (GRCh38)
Location 16:29991943-29991965 16:29991956-29991978
Sequence CCACAGGGCAGAGCAGGTCTGGG CAGGTCTGGGGCCTGAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 445} {0: 1, 1: 0, 2: 6, 3: 65, 4: 672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!