ID: 1136399643_1136399653

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1136399643 1136399653
Species Human (GRCh38) Human (GRCh38)
Location 16:30010536-30010558 16:30010566-30010588
Sequence CCGGGGCTCCCCTCTGCTCCTGA TGTCCCCCAAGGGGCCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 612} {0: 1, 1: 0, 2: 4, 3: 21, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!