ID: 1136399644_1136399653

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1136399644 1136399653
Species Human (GRCh38) Human (GRCh38)
Location 16:30010544-30010566 16:30010566-30010588
Sequence CCCCTCTGCTCCTGAGCCTGCCT TGTCCCCCAAGGGGCCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 5, 3: 79, 4: 592} {0: 1, 1: 0, 2: 4, 3: 21, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!