ID: 1136402307_1136402318

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1136402307 1136402318
Species Human (GRCh38) Human (GRCh38)
Location 16:30025299-30025321 16:30025330-30025352
Sequence CCAGGTTGACGTGGGCAGGGATG CACGGCCAGCAGGGGCAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156} {0: 1, 1: 0, 2: 4, 3: 68, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!