ID: 1136414832_1136414847

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1136414832 1136414847
Species Human (GRCh38) Human (GRCh38)
Location 16:30096534-30096556 16:30096582-30096604
Sequence CCCGCGTTTGTCCGCCGCCCGTG CGTGAGGCCGTTTCTCCCGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15} {0: 1, 1: 0, 2: 1, 3: 0, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!