ID: 1136414836_1136414851

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1136414836 1136414851
Species Human (GRCh38) Human (GRCh38)
Location 16:30096551-30096573 16:30096597-30096619
Sequence CCCGTGCCCCGCTCAATCCCCGC CCCGTTGGCTCCACTGTACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125} {0: 1, 1: 1, 2: 1, 3: 11, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!