ID: 1136414837_1136414855

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1136414837 1136414855
Species Human (GRCh38) Human (GRCh38)
Location 16:30096552-30096574 16:30096605-30096627
Sequence CCGTGCCCCGCTCAATCCCCGCA CTCCACTGTACCGGGGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 175} {0: 1, 1: 0, 2: 1, 3: 12, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!