ID: 1136414842_1136414853

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1136414842 1136414853
Species Human (GRCh38) Human (GRCh38)
Location 16:30096568-30096590 16:30096598-30096620
Sequence CCCCGCATCAATCCCGTGAGGCC CCGTTGGCTCCACTGTACCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54} {0: 1, 1: 0, 2: 1, 3: 3, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!