ID: 1136414842_1136414857

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1136414842 1136414857
Species Human (GRCh38) Human (GRCh38)
Location 16:30096568-30096590 16:30096611-30096633
Sequence CCCCGCATCAATCCCGTGAGGCC TGTACCGGGGGCTGAGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54} {0: 1, 1: 0, 2: 0, 3: 16, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!