ID: 1136414852_1136414861

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1136414852 1136414861
Species Human (GRCh38) Human (GRCh38)
Location 16:30096598-30096620 16:30096623-30096645
Sequence CCGTTGGCTCCACTGTACCGGGG TGAGGCCCAGGGAGGTCTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64} {0: 1, 1: 1, 2: 2, 3: 38, 4: 453}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!